code by Steven H. D. Haddock and Casey W. Dunn as described in:
Practical Computing for Biologists
by Steven H. D. Haddock and Casey W. Dunn
published in 2011 by Sinauer Associates.
ISBN 978-0-87893-391-4http://www.sinauer.com/practical-computing-for-biologists.html
see practicalcomputing.orgscripts freely available by the original authors at practicalcomputing.org
DIRECT LINK: http://practicalcomputing.org/files/pcfb_examples.zip
Updated to Python 3 by Wayne Decaturposted as a Gist and IPython Notebook by Wayne (fomightez at GitHub) with full credit and reference to original code authors.¶
DNASeq = "AGTCTCTGACTCTCTCTTCGGTCTCT" #DNASeq = raw_input("Enter a sequence: ")
DNASeq = DNASeq.upper() # convert to uppercase for .count() function
DNASeq = DNASeq.replace(" ","") # remove spaces
print ('Sequence:', DNASeq)
# below are nested functions: first find the length, then make it float
SeqLength = float(len(DNASeq))
print ("Sequence Length:", SeqLength)
NumberA = DNASeq.count('A')
NumberC = DNASeq.count('C')
NumberG = DNASeq.count('G')
NumberT = DNASeq.count('T')
# Old way to output the Numbers
# print "A:", NumberA/SeqLength
# print "C:", NumberC/SeqLength
# print "G:", NumberG/SeqLength
# print "T:", NumberT/SeqLength
# Calculate percentage and output to 1 decimal
print ("A: %.1f" % (100 * NumberA / SeqLength))
print ("C: %.1f" % (100 * NumberC / SeqLength))
print ("G: %.1f" % (100 * NumberG / SeqLength))
print ("T: %.1f" % (100 * NumberT / SeqLength))
Sequence: AGTCTCTGACTCTCTCTTCGGTCTCT Sequence Length: 26.0 A: 7.7 C: 34.6 G: 15.4 T: 42.3
See the code in action and explore it interactively here.
Obtain a copy of this entire IPython Notebook here in order to explore it interactively.
%whos
Variable Type Data/Info ------------------------------ DNASeq str AGTCTCTGACTCTCTCTTCGGTCTCT NumberA int 2 NumberC int 9 NumberG int 4 NumberT int 11 SeqLength float 26.0
The above special command lets us see what is defined and can be used in an IPython Notebook.
(For some reason it doesn't work for any of the initiating variables over in the interactive gist console.)