Notebook

dnacalc.py¶

code by Steven H. D. Haddock and Casey W. Dunn as described in:
Practical Computing for Biologists
by Steven H. D. Haddock and Casey W. Dunn
published in 2011 by Sinauer Associates.
ISBN 978-0-87893-391-4

http://www.sinauer.com/practical-computing-for-biologists.html
see practicalcomputing.org

scripts freely available by the original authors at practicalcomputing.org
DIRECT LINK: http://practicalcomputing.org/files/pcfb_examples.zip
Updated to Python 3 by Wayne Decatur

posted as a Gist and IPython Notebook by Wayne (fomightez at GitHub) with full credit and reference to original code authors.¶

dnacalc.py calculates percent of bases in a DNA sequence.
# This program takes a DNA sequence (without checking)
# and shows its length and the nucleotide composition
# This program is described in Chapter 8 of PCfB
The code:¶

In [1]:

DNASeq = "AGTCTCTGACTCTCTCTTCGGTCTCT" #DNASeq = raw_input("Enter a sequence: ")
DNASeq = DNASeq.upper()  # convert to uppercase for .count() function
DNASeq = DNASeq.replace(" ","") # remove spaces

print ('Sequence:', DNASeq)
 
# below are nested functions: first find the length, then make it float
 
SeqLength = float(len(DNASeq)) 
 
print ("Sequence Length:", SeqLength)
 
NumberA = DNASeq.count('A')
NumberC = DNASeq.count('C')
NumberG = DNASeq.count('G')
NumberT = DNASeq.count('T')
 
# Old way to output the Numbers
# print "A:", NumberA/SeqLength
# print "C:", NumberC/SeqLength
# print "G:", NumberG/SeqLength
# print "T:", NumberT/SeqLength
 
# Calculate percentage and output to 1 decimal
print ("A: %.1f" % (100 * NumberA / SeqLength))
print ("C: %.1f" % (100 * NumberC / SeqLength))
print ("G: %.1f" % (100 * NumberG / SeqLength))
print ("T: %.1f" % (100 * NumberT / SeqLength))

Sequence: AGTCTCTGACTCTCTCTTCGGTCTCT
Sequence Length: 26.0
A: 7.7
C: 34.6
G: 15.4
T: 42.3

See the code in action and explore it interactively here.

Obtain a copy of this entire IPython Notebook here in order to explore it interactively.

Additional aid and exploration below:¶

In [2]:

%whos

Variable    Type     Data/Info
------------------------------
DNASeq      str      AGTCTCTGACTCTCTCTTCGGTCTCT
NumberA     int      2
NumberC     int      9
NumberG     int      4
NumberT     int      11
SeqLength   float    26.0

The above special command lets us see what is defined and can be used in an IPython Notebook.
(For some reason it doesn't work for any of the initiating variables over in the interactive gist console.)

dnacalc.py¶

posted as a Gist and IPython Notebook by Wayne (fomightez at GitHub) with full credit and reference to original code authors.¶

dnacalc.py calculates percent of bases in a DNA sequence. # This program takes a DNA sequence (without checking) # and shows its length and the nucleotide composition # This program is described in Chapter 8 of PCfB The code:¶

Additional aid and exploration below:¶

See the subsequent variations that build upon these ideas and make more versatile versions as described in the book.¶

dnacalc.py calculates percent of bases in a DNA sequence.
# This program takes a DNA sequence (without checking)
# and shows its length and the nucleotide composition
# This program is described in Chapter 8 of PCfB
The code:¶