#!/usr/bin/env python
# coding: utf-8

# # compositioncalc1.py

# >code by Steven H. D. Haddock and Casey W. Dunn as described in:  
# >Practical Computing for Biologists  
# >by Steven H. D. Haddock and Casey W. Dunn  
# >published in 2011 by Sinauer Associates.  
# >ISBN 978-0-87893-391-4  
# >
# >[http://www.sinauer.com/practical-computing-for-biologists.html](http://www.sinauer.com/practical-computing-for-biologists.html)  
# >see [practicalcomputing.org](practicalcomputing.org)  
# >
# >scripts freely available by the original authors at practicalcomputing.org  
# >DIRECT LINK: [http://practicalcomputing.org/files/pcfb_examples.zip](http://practicalcomputing.org/files/pcfb_examples.zip)  
# >Updated to Python 3 by Wayne Decatur  
# >#### posted as a Gist and IPython Notebook by Wayne (fomightez at GitHub) with full credit and reference to original code authors.

# #### compositioncalc1.py calculates percent of the four bases (A,C,G,&T) in a DNA sequence.  <br/>  The code:

# In[1]:


DNASeq = "ATGTCTCATTCAAAGCA"
SeqLength = float(len(DNASeq))
 
BaseList = "ACGT"
for Base in BaseList:
  Percent = 100 * DNASeq.count(Base) / SeqLength
  print ("%s: %4.1f" % (Base,Percent))
 


# **See the code in action and explore it interactively [here](https://www.pythonanywhere.com/gists/6076502/compositioncalc1.py/ipython2/).**  

# **Obtain a copy of this entire IPython Notebook [here](https://gist.github.com/fomightez/6077226) in order to explore it interactively.** 

# 
# 
# 
# 
#  
#       
#          
#             

# ### <br/> Additional aid and exploration below:

# In[2]:


get_ipython().run_line_magic('whos', '')


# The above special command lets us see what is defined and can be used in an IPython Notebook.   
# (For some reason it doesn't work for any of the initiating variables over in the interactive gist console.)

#   
#        
#           

#   _We can go ahead and define a function that will do this caculation:_

# In[3]:


def calc(MyDNASeq):
  SeqLength = float(len(MyDNASeq))
  BaseList = "ACGT"
  for Base in BaseList:
    Percent = 100 * MyDNASeq.count(Base) / SeqLength
    print ("%s: %4.1f" % (Base,Percent))


# _Then define a variable_

# In[4]:


MyDNASeq="TTGGGGGGCGAAAA"


# _Then we feed that variable to the function:_

# In[5]:


calc(MyDNASeq)


# _In fact, we can even skip the variable and directly input the sequence into the function:_

# In[6]:


calc("TGTTTTTCTTTTTCCCCCCCAAAA")